| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.070333 |
| Chromosome: | chromosome 12 |
| Location: | 8790301 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545300 | (1 of 2) PTHR21514//PTHR21514:SF0 - UNCHARACTERIZED // AP-4 COMPLEX ACCESSORY SUBUNIT TEPSIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGCGCCGTGGCAGCTGGGCACTGGGGC |
| Internal bar code: | GGTGATAGGATGCAAAGAAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 145 |
| LEAP-Seq percent confirming: | 64.5273 |
| LEAP-Seq n confirming: | 744 |
| LEAP-Seq n nonconfirming: | 409 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAGCTCGTACACCCCT |
| Suggested primer 2: | GCGGTGTATTTGACCGACTT |