Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.070360 |
Chromosome: | chromosome 2 |
Location: | 1002473 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g080350 | (1 of 1) K11836 - ubiquitin carboxyl-terminal hydrolase 5/13 [EC:3.4.19.12] (USP5_13, UBP14) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCATGCAGCCCTGCATATTCTGGGTTT |
Internal bar code: | GCTTCTACCTCGGAGCTGGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 171 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACACGCATACACAGCAG |
Suggested primer 2: | TGCAACAGATGGAGAAGACG |