| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.070400 |
| Chromosome: | chromosome 12 |
| Location: | 9399876 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g540050 | (1 of 12) IPR000595//IPR018490 - Cyclic nucleotide-binding domain // Cyclic nucleotide-binding-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGTACATCCTGGGCCGCTGGAGCGAGA |
| Internal bar code: | CGCCGTGCCAAAGTGCGCATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 16 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCATCCACGCTGTACCC |
| Suggested primer 2: | CATCCGCCTCTCATTTTGAT |