Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.070433 |
Chromosome: | chromosome 16 |
Location: | 3173374 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g666150 | ODA1,DCC2,DC2,ODA-DC2 | (1 of 2) PTHR21694:SF18 - COILED-COIL DOMAIN-CONTAINING PROTEIN 114; Outer Arm Dynein Docking Complex 2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGCAACCTGGAGCGGGAGCTGGCGAAGC |
Internal bar code: | GGCGTACCCCACCTCGGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 872 |
LEAP-Seq percent confirming: | 93.3198 |
LEAP-Seq n confirming: | 922 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAGAACGAGCAGCTCAAGA |
Suggested primer 2: | CTGCTGAGGACAGAGTTCCC |