| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.070444 |
| Chromosome: | chromosome 2 |
| Location: | 407376 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076050 | (1 of 2) IPR000008//IPR000104 - C2 domain // Antifreeze protein, type I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGCGAAGGGTCGCTGCGGCAGGCTGCT |
| Internal bar code: | TCACGGCTTCGATCTTCGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 180 |
| LEAP-Seq percent confirming: | 51.8099 |
| LEAP-Seq n confirming: | 1417 |
| LEAP-Seq n nonconfirming: | 1318 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGACTTCCTGGATCGGG |
| Suggested primer 2: | GGATCCACAGCACCAAAGTT |