| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.070496 |
| Chromosome: | chromosome 1 |
| Location: | 52991 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000250 | SNR1 | (1 of 2) PTHR12677:SF5 - TVP38/TMEM64 FAMILY MEMBRANE PROTEIN YDJX; Predicted SNARE-associated Golgi protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCACCTGCCTGTCACACCTTGCCTTTG |
| Internal bar code: | TCGGACTCAGCCCGTGGCCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 112 |
| LEAP-Seq percent confirming: | 74.442 |
| LEAP-Seq n confirming: | 1334 |
| LEAP-Seq n nonconfirming: | 458 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCAAGGGTTCTGGCATGT |
| Suggested primer 2: | GCAATGCGTACGGAACCTAT |