| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.070523 |
| Chromosome: | chromosome 1 |
| Location: | 6163858 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044100 | AMYB3,AMB3 | Beta-amylase 3; (1 of 3) 3.2.1.2 - Beta-amylase / Saccharogen amylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTCTTGAGCCACAGGCAGCATTCCGCG |
| Internal bar code: | CTGTGCGATGCCCTTAACCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 248 |
| LEAP-Seq percent confirming: | 55.2245 |
| LEAP-Seq n confirming: | 4133 |
| LEAP-Seq n nonconfirming: | 3351 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTATGTGCATGTCTGGTGC |
| Suggested primer 2: | GCTACCGAATGTCCGAGTCT |