Insertion junction: LMJ.RY0402.070564_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.070564
Chromosome:chromosome_6
Location:1731022
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGAGCTGCATGCTACACCATGCTATCTGG
Internal bar code:CGACGCCGGTGAACGGGCAGAC

Confirmation - LEAP-Seq

LEAP-Seq distance:176
LEAP-Seq percent confirming:67.2358
LEAP-Seq n confirming:1654
LEAP-Seq n nonconfirming:806
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:GTATGAAGGTCACCGCCTGT
Suggested primer 2:TGCATTTGCAAAACCCACTA