| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.070655 |
| Chromosome: | chromosome 16 |
| Location: | 7539610 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688302 | (1 of 1) K08999 - hypothetical protein (K08999) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGCACCTACAGCCCCCACTCCCCAAAA |
| Internal bar code: | AGTCGTTAAGTGCGCTGTTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 68.8757 |
| LEAP-Seq n confirming: | 582 |
| LEAP-Seq n nonconfirming: | 263 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCAGAGGGTGGTGAGAAG |
| Suggested primer 2: | GAATTGCGTAAGCTGCATGA |