| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.070664 |
| Chromosome: | chromosome 17 |
| Location: | 893431 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702700 | TPT28,TPT27 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 1) PTHR11132//PTHR11132:SF101//PTHR11132:SF125 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCTGATGTACCTGGCGCCCGCATGCA |
| Internal bar code: | ACGAGGTGGTTAGGAGCACTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 90.9846 |
| LEAP-Seq n confirming: | 767 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGTACACGGGCAGGAAC |
| Suggested primer 2: | CACCACTCCCACACACACTC |