| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.070706 |
| Chromosome: | chromosome 15 |
| Location: | 283241 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g635600 | NPC1,EGD2 | (1 of 1) K03626 - nascent polypeptide-associated complex subunit alpha (EGD2, NACA); GAL4 DNA-binding enhancer protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACACATGCGCCATGTTCAGCATCCCTG |
| Internal bar code: | TGGCATACCGGAGGTGGTACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 244 |
| LEAP-Seq percent confirming: | 94.6055 |
| LEAP-Seq n confirming: | 1175 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGATGTAGGTGTCCGAGGC |
| Suggested primer 2: | TGCGTCGTGGTATCAATGTT |