Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.070756 |
Chromosome: | chromosome 12 |
Location: | 9174148 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g542150 | (1 of 3) PF14108 - Domain of unknown function (DUF4281) (DUF4281) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGGCCGCACACATCCAGCATACACATA |
Internal bar code: | AGGGATAAACGGCCGTGAGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 484 |
LEAP-Seq percent confirming: | 99.5994 |
LEAP-Seq n confirming: | 1243 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTCCTTGCTGAAGGTGCT |
Suggested primer 2: | TGCTGCATGACCTTTCTTTG |