| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071031 |
| Chromosome: | chromosome 6 |
| Location: | 436277 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g252350 | CGL70 | (1 of 1) PTHR33102:SF13 - DVL17; Conserved in the Green Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGCCGGAACATAGCATGAGGTCACGAT |
| Internal bar code: | GGCGTCATGATCGACCCGCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 182 |
| LEAP-Seq percent confirming: | 90.9938 |
| LEAP-Seq n confirming: | 2637 |
| LEAP-Seq n nonconfirming: | 261 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGTCGTCCTGGTACTGT |
| Suggested primer 2: | GGCAGAACCTCAGTACTCGC |