Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.071031 |
Chromosome: | chromosome 13 |
Location: | 3713112 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589200 | (1 of 21) IPR011016 - Zinc finger, RING-CH-type | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAACAACACCTGCTGCCGGTGAGTCGAAT |
Internal bar code: | GTCTCTTCCGTCGACACAGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 172 |
LEAP-Seq percent confirming: | 12.1362 |
LEAP-Seq n confirming: | 1126 |
LEAP-Seq n nonconfirming: | 8152 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGACTTGTTCCAGCGTCA |
Suggested primer 2: | ATTTGCATCTGCTGTTGCTG |