Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.071041 |
Chromosome: | chromosome 17 |
Location: | 3105414 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g721250 | QilinDyf-3,FAP22,IFT38,Cluap1 | (1 of 1) PF10234 - Clusterin-associated protein-1 (Cluap1); Intraflagellar Transport Protein 38 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCTGAAACTGACGTCTGACCGGCATCA |
Internal bar code: | GATTCCTTGTTATGATCAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 758 |
LEAP-Seq percent confirming: | 93.9463 |
LEAP-Seq n confirming: | 4547 |
LEAP-Seq n nonconfirming: | 293 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGTATCCAAGTCCGCTGC |
Suggested primer 2: | AGGATGACGACGAGGATGAC |