| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071118 |
| Chromosome: | chromosome 16 |
| Location: | 7673227 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690095 | (1 of 2) IPR000742//IPR017853 - EGF-like domain // Glycoside hydrolase superfamily | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTACCTAGGCCATCCGGGCACACGCTCA |
| Internal bar code: | GGGTCGAGTATTCGGTGTTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 491 |
| LEAP-Seq percent confirming: | 99.1018 |
| LEAP-Seq n confirming: | 1655 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAATGGATGCTGGAGGTT |
| Suggested primer 2: | GTGTGGTCCGAACTGTTGTG |