| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.071171 |
| Chromosome: | chromosome 11 |
| Location: | 753407 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467631 | CGL90 | Zinc carboxypeptidase; Conserved in green lineage; (1 of 1) 3.4.17.15 - Carboxypeptidase A2 | 3'UTR|intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCATCGGCACTGGAAGGCATTGTTCAG |
| Internal bar code: | TGCTGAGGACCAGTACCCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 554 |
| LEAP-Seq percent confirming: | 96.0094 |
| LEAP-Seq n confirming: | 1227 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCGCTGTCCTCCATAAG |
| Suggested primer 2: | TGCGAATTCAAAGCAATGAG |