| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071251 |
| Chromosome: | chromosome 7 |
| Location: | 4573411 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g343933 | EBM6 | (1 of 4) K19355 - mannan endo-1,4-beta-mannosidase (MAN); Mannan endo-1%252C4-beta-mannosidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGTCCGTCGGTCCGTGGCTTCGGCCAT |
| Internal bar code: | CTAATTCTGCCCTGCATGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 208 |
| LEAP-Seq percent confirming: | 99.3832 |
| LEAP-Seq n confirming: | 6929 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGGTCTCCGTCTAGTCA |
| Suggested primer 2: | AGTGGTAGGGGTGACTGTGC |