| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071315 |
| Chromosome: | chromosome 10 |
| Location: | 751930 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g422800 | HER1 | DnaJ-domain protein; (1 of 1) PF00226//PF00570 - DnaJ domain (DnaJ) // HRDC domain (HRDC) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCAACTTTGCCCACGCTGCTGCAGGACA |
| Internal bar code: | GGGCGCTCCGAGAAGGGCTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 787 |
| LEAP-Seq percent confirming: | 98.6417 |
| LEAP-Seq n confirming: | 2687 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTTATTGTGGCCAGCTT |
| Suggested primer 2: | CTTTCTCATATGCGGTGCCT |