| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.071333 |
| Chromosome: | chromosome 2 |
| Location: | 1759655 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086550 | CGL122 | (1 of 4) K06941 - 23S rRNA (adenine2503-C2)-methyltransferase [EC:2.1.1.192] (rlmN); predicted Fe-S-cluster redox enzyme | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACGAGGCGGCGGCTGCAGCAGTCTCACA |
| Internal bar code: | GGTTTACGCGTGATTGGGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 25 |
| LEAP-Seq percent confirming: | 73.5834 |
| LEAP-Seq n confirming: | 922 |
| LEAP-Seq n nonconfirming: | 331 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGGAACTCTTGCACGCTA |
| Suggested primer 2: | GGGGATTACGGATTTACGGT |