Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.071355 |
Chromosome: | chromosome 12 |
Location: | 5223652 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g528100 | CPZ | Zinc carboxypeptidase; (1 of 1) PTHR12756:SF12 - CYTOSOLIC CARBOXYPEPTIDASE-LIKE PROTEIN 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGTGGGCAAGTTCACGTTCCGTGCGG |
Internal bar code: | GAGGAGAGTGGATTGTAGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 820 |
LEAP-Seq percent confirming: | 99.8009 |
LEAP-Seq n confirming: | 3007 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGCAAAATCATACCACGC |
Suggested primer 2: | TCCCCTGCTTATTCAGGTTG |