| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071379 |
| Chromosome: | chromosome 12 |
| Location: | 4564013 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522350 | TSW1 | (1 of 2) 6.1.1.2 - Tryptophan--tRNA ligase / Tryptophanyl-tRNA synthetase; Trryptophanyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGCCTCGACAGGGAAGAGGGTGGGCAT |
| Internal bar code: | GGCGCATGAGCGGTTGCTTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 230 |
| LEAP-Seq percent confirming: | 72.6932 |
| LEAP-Seq n confirming: | 3104 |
| LEAP-Seq n nonconfirming: | 1166 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCAGAACTTTCCGGCAC |
| Suggested primer 2: | TGTATGAGCCCCTTTTGAGG |