| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071416 |
| Chromosome: | chromosome 7 |
| Location: | 2791969 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g331550 | PST1 | Phosphoserine aminotransferase; (1 of 1) K00831 - phosphoserine aminotransferase (serC, PSAT1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCGGCCTTGCGGCGTTGCTGCATTCTT |
| Internal bar code: | CGTATCAAAATGGGGCACTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 71 |
| LEAP-Seq percent confirming: | 67.0788 |
| LEAP-Seq n confirming: | 1302 |
| LEAP-Seq n nonconfirming: | 639 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGGGCTGTGTGTATTGC |
| Suggested primer 2: | GTTGTGCGGGGTCTACTGAT |