| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071505 |
| Chromosome: | chromosome 7 |
| Location: | 2858051 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332150 | LYRM7 | LYR motif-containing protein 7; (1 of 1) K18170 - complex III assembly factor LYRM7 (LYRM7, MZM1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTCTACGACGATGGATTCCTTCTTTCT |
| Internal bar code: | CGCGTCTCTTTTGGGCCGAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 315 |
| LEAP-Seq percent confirming: | 93.7858 |
| LEAP-Seq n confirming: | 5237 |
| LEAP-Seq n nonconfirming: | 347 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCTCTGGGGCAATCTCTG |
| Suggested primer 2: | ATGAAATCGCTCAGGAATGG |