| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071522 |
| Chromosome: | chromosome 11 |
| Location: | 1245046 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467702 | MRPS3,uS3m | (1 of 3) PF00189 - Ribosomal protein S3, C-terminal domain (Ribosomal_S3_C); Mitochondrial ribosomal protein S3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCGCGCATCCGCCGCAACCAGCCCCGA |
| Internal bar code: | AATCATCCGATCGATGCAGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 104 |
| LEAP-Seq percent confirming: | 86.2857 |
| LEAP-Seq n confirming: | 151 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATAACGGCACCTGACC |
| Suggested primer 2: | GTGACAAACACGAGAGCGAA |