| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.071528 |
| Chromosome: | chromosome 10 |
| Location: | 3225514 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g442850 | TOP1A | Topoisomerase type IA, chlloroplast-targeted; (1 of 1) K03168 - DNA topoisomerase I [EC:5.99.1.2] (topA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGTAGCAAGCGGGCTCCGGCTGTTGCT |
| Internal bar code: | TTCTGACGGCTATTGCCACTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 99.557 |
| LEAP-Seq n confirming: | 3371 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTACTCCTGAATCCACCG |
| Suggested primer 2: | TACCATATGCGTGAATGCGT |