Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.071652 |
Chromosome: | chromosome 13 |
Location: | 1588482 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g573300 | CDD4 | (1 of 1) K11991 - tRNA(adenine34) deaminase [EC:3.5.4.33] (tadA); Cytosine deaminase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACGGCGGCCAGCCGCAATGGTTGGGTGT |
Internal bar code: | CCAAAACATTGACTTAGCAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 567 |
LEAP-Seq percent confirming: | 99.6372 |
LEAP-Seq n confirming: | 1648 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCTCCTCCACAGTAGCAA |
Suggested primer 2: | AGAGGCCGCTTGAATAGTGA |