| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.071755 |
| Chromosome: | chromosome 10 |
| Location: | 979629 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424775 | CTP2,PCH1,PAA1 | Copper transporting ATPase and Cu chaperone for CTP1; (1 of 1) PTHR24093:SF124 - COPPER-TRANSPORTING ATPASE PAA1, CHLOROPLASTIC | 3'UTR|intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATTACAGTTGCAACCGTACGACCAGCT |
| Internal bar code: | AGGAACCGAGGGCCCGCCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 770 |
| LEAP-Seq percent confirming: | 97.9782 |
| LEAP-Seq n confirming: | 630 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACATACACACGCACCC |
| Suggested primer 2: | GTGTGTCGTGAGGTTCCCTT |