| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.071758 |
| Chromosome: | chromosome 12 |
| Location: | 4827584 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524650 | HDA18,SRTB1,SRTB | (1 of 1) K11414 - NAD-dependent deacetylase sirtuin 4 [EC:3.5.1.-] (SIRT4, SIR2L4); Sir2-like NADH dependent histone deacetylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGAGGTCCTGTGTAGGCGGGGCCGCGT |
| Internal bar code: | CTTACATGCGCATGTAGCGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 98.8621 |
| LEAP-Seq n confirming: | 3736 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCACCTTTGGTCACAGAA |
| Suggested primer 2: | CTTGATGTCCGTGGACCTTT |