Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.071779 |
Chromosome: | chromosome 3 |
Location: | 5708158 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g187950 | SEE1 | Putative splicing endonuclease positive effector; (1 of 3) K10706 - senataxin [EC:3.6.4.-] (SETX, ALS4) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCAAGATCGAGACCGTGGACTCGTTCCA |
Internal bar code: | AATTTGATGGACTCGCCATTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 115 |
LEAP-Seq percent confirming: | 99.8427 |
LEAP-Seq n confirming: | 5714 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAGGAGTCAGGAGAAGGC |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |