| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.071779 |
| Chromosome: | chromosome 3 |
| Location: | 5708158 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187950 | SEE1 | Putative splicing endonuclease positive effector; (1 of 3) K10706 - senataxin [EC:3.6.4.-] (SETX, ALS4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCAAGATCGAGACCGTGGACTCGTTCCA |
| Internal bar code: | AATTTGATGGACTCGCCATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 99.8427 |
| LEAP-Seq n confirming: | 5714 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGGAGTCAGGAGAAGGC |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |