| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.071928 |
| Chromosome: | chromosome 16 |
| Location: | 7626792 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689647 | AGO3 | (1 of 2) K11593 - eukaryotic translation initiation factor 2C (ELF2C, AGO); Argonaute-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACTGGGGAGGAAAGCTGGGTGGTAAAT |
| Internal bar code: | CAGCCGTCGGGAAGTAGATCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 37 |
| LEAP-Seq percent confirming: | 99.2407 |
| LEAP-Seq n confirming: | 4313 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGGTGAAGGTTGTAGCA |
| Suggested primer 2: | ACCACTAAACCACCACAGGC |