| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.071937 |
| Chromosome: | chromosome 12 |
| Location: | 6118534 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g535900 | ARL1 | ARF-like GTPase; (1 of 1) K07942 - ADP-ribosylation factor-like protein 1 (ARL1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGCCTCTGCGCATCCGCGTGTCCAGCA |
| Internal bar code: | CTCGAAAGTATCATATGTTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 99.6781 |
| LEAP-Seq n confirming: | 2787 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTCATAATGGCAGGGTGC |
| Suggested primer 2: | TGGTAACCACCAGCACATTG |