| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.071978 |
| Chromosome: | chromosome 13 |
| Location: | 58242 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g562300 | HON2 | Histone H1; (1 of 3) K11275 - histone H1/5 (H1_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTAGAAACCAGAGGTCCCGGCCGAGGGG |
| Internal bar code: | GCGGATAGATCTGGGTATTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 361 |
| LEAP-Seq percent confirming: | 99.7587 |
| LEAP-Seq n confirming: | 2894 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAATGAGGGTGTGACG |
| Suggested primer 2: | CGGCACCAAGGTAAACAACT |