| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.071989 |
| Chromosome: | chromosome 7 |
| Location: | 5199868 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348600 | SULP1,SLP1 | Chloroplast sulfate permease; (1 of 1) K02046 - sulfate transport system permease protein (cysU) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGCATGGTATGGGGCCAGTTGGGCAGG |
| Internal bar code: | GTTCGTATCAGGAGTGTGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 802 |
| LEAP-Seq percent confirming: | 99.3647 |
| LEAP-Seq n confirming: | 5474 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACTAGCTGCCTCGAACC |
| Suggested primer 2: | TAAACAGTGAGTCCCCGTCC |