| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071999 |
| Chromosome: | chromosome 1 |
| Location: | 4457587 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030300 | (1 of 2) PF08627 - CRT-like, chloroquine-resistance transporter-like (CRT-like) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCTAGCGGCTGGCCCAGCTTTTTAGCC |
| Internal bar code: | GTCCGGGACGGTCTTGCAGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 728 |
| LEAP-Seq percent confirming: | 57.4904 |
| LEAP-Seq n confirming: | 2694 |
| LEAP-Seq n nonconfirming: | 1992 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTGCGCTACTGCCAACTT |
| Suggested primer 2: | TACCGGGCAAGTAACTACGG |