Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.072008 |
Chromosome: | chromosome 12 |
Location: | 6120209 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g535900 | ARL1 | ARF-like GTPase; (1 of 1) K07942 - ADP-ribosylation factor-like protein 1 (ARL1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTGCCAAGGGCAGGAGTCAGATGCATC |
Internal bar code: | GTGGCGTAGAAAACTGCAGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 300 |
LEAP-Seq percent confirming: | 59.9564 |
LEAP-Seq n confirming: | 3300 |
LEAP-Seq n nonconfirming: | 2204 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACCCTGCCATTATGAGTT |
Suggested primer 2: | AAATGCCAGTCATAGGGACG |