Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.072075 |
Chromosome: | chromosome 4 |
Location: | 2859826 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g224400 | (1 of 1) 3.6.3.25//3.6.3.44 - Sulfate-transporting ATPase // Xenobiotic-transporting ATPase / Steroid-transporting ATPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTACTCCGTGGGGTCGGGTTGATTCAC |
Internal bar code: | TCCACCTTTTAGAGCTTGAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 444 |
LEAP-Seq percent confirming: | 97.3765 |
LEAP-Seq n confirming: | 15218 |
LEAP-Seq n nonconfirming: | 410 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTTACTGGTGTGCGGTT |
Suggested primer 2: | GCAGGAATAGAAATGCGGAG |