Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.072139 |
Chromosome: | chromosome 2 |
Location: | 6008753 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g112300 | MOT15,CAL3 | Calpain family cysteine protease; (1 of 2) K08582 - calpain-15 [EC:3.4.22.-] (CAPN15) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTACTGCGTGTACTCGCGCGTGTCAAAC |
Internal bar code: | TAAATTGATCGGACGCCGGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 598 |
LEAP-Seq percent confirming: | 97.8566 |
LEAP-Seq n confirming: | 1187 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACAGGTCATGCTCTGCAA |
Suggested primer 2: | GTACGGTGCTGTCTTGCCTT |