Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.072161 |
Chromosome: | chromosome 9 |
Location: | 2597914 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390450 | POB15 | Proteome of basal body 15; (1 of 88) IPR011333 - POZ domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGACTTCGCGGACTGCCGAATCGTGTT |
Internal bar code: | TGGAGGAATAGTCAAAGGTGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 59 |
LEAP-Seq percent confirming: | 96.267 |
LEAP-Seq n confirming: | 851 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTAGGTACCCGGCTTGTGA |
Suggested primer 2: | ACACACACACACACACACCG |