Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.072173 |
Chromosome: | chromosome 1 |
Location: | 7892375 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g063267 | BLP1 | Bystin-like protein; (1 of 1) K14797 - essential nuclear protein 1 (ENP1, BYSL) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGTATAGACGCATGAAGAGGGTTGCAG |
Internal bar code: | GGGACCTCTAGAGGCAGAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 90 |
LEAP-Seq percent confirming: | 99.3646 |
LEAP-Seq n confirming: | 2502 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACCACACGAGTACCACAG |
Suggested primer 2: | CCGATGAGGATGAAGGAGAA |