| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072281 |
| Chromosome: | chromosome 3 |
| Location: | 7647922 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204150 | FAP167,IFT80 | Intraflagellar transport protein 80; (1 of 1) PTHR24098//PTHR24098:SF0 - FAMILY NOT NAMED // OSEG5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGCACCCTTGATCCCTCTCCAGCCGTC |
| Internal bar code: | GGTGTCGGAGGTTCTCTAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 754 |
| LEAP-Seq percent confirming: | 96.6427 |
| LEAP-Seq n confirming: | 5239 |
| LEAP-Seq n nonconfirming: | 182 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCTCTCCACATAGCACA |
| Suggested primer 2: | GTACTCGATTGTGTGGGCCT |