| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072287 |
| Chromosome: | chromosome 3 |
| Location: | 1638172 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152950 | PUS12 | (1 of 1) 4.2.1.70//5.4.99.12 - Pseudouridylate synthase / Uracil hydrolyase // tRNA pseudouridine(38-40) synthase / tRNA pseudouridylate synthase I; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCCATGCGATGTGCAGCGTGCCTTCTC |
| Internal bar code: | TAGCCCACGGGCCTGGTACGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 675 |
| LEAP-Seq percent confirming: | 94.9089 |
| LEAP-Seq n confirming: | 7811 |
| LEAP-Seq n nonconfirming: | 419 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACACACACGGT |
| Suggested primer 2: | AACCCACGTCTCACAAGACC |