Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.072324 |
Chromosome: | chromosome 17 |
Location: | 2693836 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g717900 | PHC1 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTAGTCTGCGTCATTGCATATTTTGTCA |
Internal bar code: | TAACATAGGCCTCTGCCGAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 811 |
LEAP-Seq percent confirming: | 97.7679 |
LEAP-Seq n confirming: | 219 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCACACATCCACACGAGA |
Suggested primer 2: | CAGTCGTTCTGGCTGTCAAA |