| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.072384 |
| Chromosome: | chromosome 17 |
| Location: | 755371 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701350 | (1 of 1) K10743 - ribonuclease H2 subunit A (RNASEH2A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTGCGCCAGACCAGCTGCACCCCAGAC |
| Internal bar code: | AGCGCCGCAACCACAGGTGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 98.7733 |
| LEAP-Seq n confirming: | 2174 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATAGTGCAGGGTGCTGAGA |
| Suggested primer 2: | CGGAGTTTCGCTTGAGGTAG |