| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.072444 |
| Chromosome: | chromosome 10 |
| Location: | 524580 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g421250 | EXO70 | (1 of 1) K07195 - exocyst complex component 7 (EXOC7, EXO70); Component of the Exocyst Complex | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCAGGGCGCGGCTGCGGGCCTGTGTG |
| Internal bar code: | GGTCCGATTGGTTACGTGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 99.6942 |
| LEAP-Seq n confirming: | 978 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGCAGGCTAACTGGTGT |
| Suggested primer 2: | CAACTCTCTCCCACTGGAGC |