| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072514 |
| Chromosome: | chromosome 12 |
| Location: | 3724597 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514800 | (1 of 2) K06287 - septum formation protein (maf) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATAGAACACCTCGCCCTCCTCGATCAGCC |
| Internal bar code: | GAAGGCGCGCAATTGATAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 183 |
| LEAP-Seq percent confirming: | 76.0827 |
| LEAP-Seq n confirming: | 2354 |
| LEAP-Seq n nonconfirming: | 740 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCCATTGCTTGTGTTCA |
| Suggested primer 2: | GCATGGGAGTCCAGTGAGTT |