Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.072602 |
Chromosome: | chromosome 17 |
Location: | 7102694 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g747297 | FAP37 | Flagellar Associated Protein 37; (1 of 1) K04794 - peptidyl-tRNA hydrolase, PTH2 family [EC:3.1.1.29] (PTH2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGTGAGCAAGCAGGCGAGCGACCGGAC |
Internal bar code: | TCCCGACGACGCACTCGGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 309 |
LEAP-Seq percent confirming: | 77.6755 |
LEAP-Seq n confirming: | 4979 |
LEAP-Seq n nonconfirming: | 1431 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCTGACGAGTCCGAGATG |
Suggested primer 2: | GCTCTTGACAGAGCAAACCC |