| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072721 |
| Chromosome: | chromosome 9 |
| Location: | 6199180 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406000 | BPL1 | Biotin-protein ligase; (1 of 1) 6.3.4.11//6.3.4.15 - Biotin--[methylcrotonoyl-CoA-carboxylase] ligase / Biotin--[methylcrotonoyl-CoA-carboxylase] synthetase // Biotin--[acetyl-CoA-carboxylase] ligase / Biotin--protein ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCCTATCCTGGTACCATGCAGCCCCT |
| Internal bar code: | GTGTGTGAAGTCAAGGCCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 183 |
| LEAP-Seq percent confirming: | 99.4105 |
| LEAP-Seq n confirming: | 1349 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACACAATACCGCTGTC |
| Suggested primer 2: | TTGATGTTTCGCGTGCTAAG |