| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072809 |
| Chromosome: | chromosome 2 |
| Location: | 4099644 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g097650 | RPN6 | (1 of 1) K03036 - 26S proteasome regulatory subunit N6 (PSMD11, RPN6); 26S proteasome regulatory subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAGGACACCAGGACGCAGGCCGTCGC |
| Internal bar code: | AACTCGATGTCGGACGAACCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 464 |
| LEAP-Seq percent confirming: | 99.5224 |
| LEAP-Seq n confirming: | 1042 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTCACACACCCACTCAC |
| Suggested primer 2: | TACGCCACCTTTACTCCACC |