| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072936 |
| Chromosome: | chromosome 6 |
| Location: | 7387375 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299350 | FBB15 | Flagellar/basal body protein 15; (1 of 2) PF04819 - Family of unknown function (DUF716) (DUF716) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACTGACCCGCGCCACCGCGCCCTCACTC |
| Internal bar code: | GCGGACTCCGGGTACTTGTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 43 |
| LEAP-Seq percent confirming: | 86.4492 |
| LEAP-Seq n confirming: | 6890 |
| LEAP-Seq n nonconfirming: | 1080 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCGCATACGCTGTCTCTA |
| Suggested primer 2: | CCACACCATGAGCAACAAAC |